ID: 1194756436

View in Genome Browser
Species Human (GRCh38)
Location X:97744158-97744180
Sequence AATCCCCATGTGTCATGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17016
Summary {0: 461, 1: 1311, 2: 2947, 3: 5417, 4: 6880}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194756430_1194756436 7 Left 1194756430 X:97744128-97744150 CCAAATCTCATATTGCATTATAG No data
Right 1194756436 X:97744158-97744180 AATCCCCATGTGTCATGGGAGGG 0: 461
1: 1311
2: 2947
3: 5417
4: 6880
1194756426_1194756436 13 Left 1194756426 X:97744122-97744144 CCCCACCCAAATCTCATATTGCA No data
Right 1194756436 X:97744158-97744180 AATCCCCATGTGTCATGGGAGGG 0: 461
1: 1311
2: 2947
3: 5417
4: 6880
1194756428_1194756436 11 Left 1194756428 X:97744124-97744146 CCACCCAAATCTCATATTGCATT No data
Right 1194756436 X:97744158-97744180 AATCCCCATGTGTCATGGGAGGG 0: 461
1: 1311
2: 2947
3: 5417
4: 6880
1194756429_1194756436 8 Left 1194756429 X:97744127-97744149 CCCAAATCTCATATTGCATTATA No data
Right 1194756436 X:97744158-97744180 AATCCCCATGTGTCATGGGAGGG 0: 461
1: 1311
2: 2947
3: 5417
4: 6880
1194756427_1194756436 12 Left 1194756427 X:97744123-97744145 CCCACCCAAATCTCATATTGCAT No data
Right 1194756436 X:97744158-97744180 AATCCCCATGTGTCATGGGAGGG 0: 461
1: 1311
2: 2947
3: 5417
4: 6880

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194756436 Original CRISPR AATCCCCATGTGTCATGGGA GGG Intergenic
Too many off-targets to display for this crispr