ID: 1194756440

View in Genome Browser
Species Human (GRCh38)
Location X:97744167-97744189
Sequence GTGTCATGGGAGGGACACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194756431_1194756440 -9 Left 1194756431 X:97744153-97744175 CCCATAATCCCCATGTGTCATGG 0: 418
1: 1219
2: 2434
3: 3877
4: 4839
Right 1194756440 X:97744167-97744189 GTGTCATGGGAGGGACACTGTGG No data
1194756433_1194756440 -10 Left 1194756433 X:97744154-97744176 CCATAATCCCCATGTGTCATGGG 0: 402
1: 1210
2: 2456
3: 3865
4: 4759
Right 1194756440 X:97744167-97744189 GTGTCATGGGAGGGACACTGTGG No data
1194756430_1194756440 16 Left 1194756430 X:97744128-97744150 CCAAATCTCATATTGCATTATAG No data
Right 1194756440 X:97744167-97744189 GTGTCATGGGAGGGACACTGTGG No data
1194756428_1194756440 20 Left 1194756428 X:97744124-97744146 CCACCCAAATCTCATATTGCATT No data
Right 1194756440 X:97744167-97744189 GTGTCATGGGAGGGACACTGTGG No data
1194756427_1194756440 21 Left 1194756427 X:97744123-97744145 CCCACCCAAATCTCATATTGCAT No data
Right 1194756440 X:97744167-97744189 GTGTCATGGGAGGGACACTGTGG No data
1194756429_1194756440 17 Left 1194756429 X:97744127-97744149 CCCAAATCTCATATTGCATTATA No data
Right 1194756440 X:97744167-97744189 GTGTCATGGGAGGGACACTGTGG No data
1194756426_1194756440 22 Left 1194756426 X:97744122-97744144 CCCCACCCAAATCTCATATTGCA No data
Right 1194756440 X:97744167-97744189 GTGTCATGGGAGGGACACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194756440 Original CRISPR GTGTCATGGGAGGGACACTG TGG Intergenic
No off target data available for this crispr