ID: 1194756840

View in Genome Browser
Species Human (GRCh38)
Location X:97747671-97747693
Sequence CAGGTTAATCAGGGAGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194756828_1194756840 21 Left 1194756828 X:97747627-97747649 CCTGCCCCGCTCATGCCTATCTA No data
Right 1194756840 X:97747671-97747693 CAGGTTAATCAGGGAGATGGTGG No data
1194756836_1194756840 -6 Left 1194756836 X:97747654-97747676 CCTGTAACAGGATGGCTCAGGTT No data
Right 1194756840 X:97747671-97747693 CAGGTTAATCAGGGAGATGGTGG No data
1194756831_1194756840 15 Left 1194756831 X:97747633-97747655 CCGCTCATGCCTATCTAATTACC No data
Right 1194756840 X:97747671-97747693 CAGGTTAATCAGGGAGATGGTGG No data
1194756832_1194756840 6 Left 1194756832 X:97747642-97747664 CCTATCTAATTACCTGTAACAGG No data
Right 1194756840 X:97747671-97747693 CAGGTTAATCAGGGAGATGGTGG No data
1194756827_1194756840 22 Left 1194756827 X:97747626-97747648 CCCTGCCCCGCTCATGCCTATCT No data
Right 1194756840 X:97747671-97747693 CAGGTTAATCAGGGAGATGGTGG No data
1194756829_1194756840 17 Left 1194756829 X:97747631-97747653 CCCCGCTCATGCCTATCTAATTA No data
Right 1194756840 X:97747671-97747693 CAGGTTAATCAGGGAGATGGTGG No data
1194756830_1194756840 16 Left 1194756830 X:97747632-97747654 CCCGCTCATGCCTATCTAATTAC No data
Right 1194756840 X:97747671-97747693 CAGGTTAATCAGGGAGATGGTGG No data
1194756826_1194756840 26 Left 1194756826 X:97747622-97747644 CCTGCCCTGCCCCGCTCATGCCT No data
Right 1194756840 X:97747671-97747693 CAGGTTAATCAGGGAGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194756840 Original CRISPR CAGGTTAATCAGGGAGATGG TGG Intergenic
No off target data available for this crispr