ID: 1194758400

View in Genome Browser
Species Human (GRCh38)
Location X:97765001-97765023
Sequence TTAAACATACAAATAAGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194758400_1194758405 -10 Left 1194758400 X:97765001-97765023 CCCATGCTTATTTGTATGTTTAA No data
Right 1194758405 X:97765014-97765036 GTATGTTTAAGGAGGGAAGCTGG No data
1194758400_1194758406 -7 Left 1194758400 X:97765001-97765023 CCCATGCTTATTTGTATGTTTAA No data
Right 1194758406 X:97765017-97765039 TGTTTAAGGAGGGAAGCTGGAGG No data
1194758400_1194758407 -4 Left 1194758400 X:97765001-97765023 CCCATGCTTATTTGTATGTTTAA No data
Right 1194758407 X:97765020-97765042 TTAAGGAGGGAAGCTGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194758400 Original CRISPR TTAAACATACAAATAAGCAT GGG (reversed) Intergenic
No off target data available for this crispr