ID: 1194758405

View in Genome Browser
Species Human (GRCh38)
Location X:97765014-97765036
Sequence GTATGTTTAAGGAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194758400_1194758405 -10 Left 1194758400 X:97765001-97765023 CCCATGCTTATTTGTATGTTTAA No data
Right 1194758405 X:97765014-97765036 GTATGTTTAAGGAGGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194758405 Original CRISPR GTATGTTTAAGGAGGGAAGC TGG Intergenic
No off target data available for this crispr