ID: 1194762714

View in Genome Browser
Species Human (GRCh38)
Location X:97813656-97813678
Sequence GTTTTTCAGGGAATTTTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194762714_1194762720 -2 Left 1194762714 X:97813656-97813678 CCCATCAAAATTCCCTGAAAAAC No data
Right 1194762720 X:97813677-97813699 ACTCCAGTCCAAACTCCATGGGG No data
1194762714_1194762726 19 Left 1194762714 X:97813656-97813678 CCCATCAAAATTCCCTGAAAAAC No data
Right 1194762726 X:97813698-97813720 GGAGGTGAATTTGAGGTTTGAGG No data
1194762714_1194762722 1 Left 1194762714 X:97813656-97813678 CCCATCAAAATTCCCTGAAAAAC No data
Right 1194762722 X:97813680-97813702 CCAGTCCAAACTCCATGGGGAGG No data
1194762714_1194762719 -3 Left 1194762714 X:97813656-97813678 CCCATCAAAATTCCCTGAAAAAC No data
Right 1194762719 X:97813676-97813698 AACTCCAGTCCAAACTCCATGGG No data
1194762714_1194762724 12 Left 1194762714 X:97813656-97813678 CCCATCAAAATTCCCTGAAAAAC No data
Right 1194762724 X:97813691-97813713 TCCATGGGGAGGTGAATTTGAGG No data
1194762714_1194762718 -4 Left 1194762714 X:97813656-97813678 CCCATCAAAATTCCCTGAAAAAC No data
Right 1194762718 X:97813675-97813697 AAACTCCAGTCCAAACTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194762714 Original CRISPR GTTTTTCAGGGAATTTTGAT GGG (reversed) Intergenic
No off target data available for this crispr