ID: 1194763646

View in Genome Browser
Species Human (GRCh38)
Location X:97824005-97824027
Sequence TTTTTTAAGGGGATGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194763646_1194763657 5 Left 1194763646 X:97824005-97824027 CCCTCCCCCATCCCCTTAAAAAA No data
Right 1194763657 X:97824033-97824055 TCATGGCAAAAGTGTCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194763646 Original CRISPR TTTTTTAAGGGGATGGGGGA GGG (reversed) Intergenic
No off target data available for this crispr