ID: 1194776478

View in Genome Browser
Species Human (GRCh38)
Location X:97971522-97971544
Sequence TGCCAGGTATAGAATATTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194776473_1194776478 23 Left 1194776473 X:97971476-97971498 CCAATTCTAGGAGAACCTATTCT No data
Right 1194776478 X:97971522-97971544 TGCCAGGTATAGAATATTTTTGG No data
1194776476_1194776478 -8 Left 1194776476 X:97971507-97971529 CCAAAGATTGCCTTTTGCCAGGT No data
Right 1194776478 X:97971522-97971544 TGCCAGGTATAGAATATTTTTGG No data
1194776474_1194776478 8 Left 1194776474 X:97971491-97971513 CCTATTCTCTTCTTTGCCAAAGA No data
Right 1194776478 X:97971522-97971544 TGCCAGGTATAGAATATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194776478 Original CRISPR TGCCAGGTATAGAATATTTT TGG Intergenic
No off target data available for this crispr