ID: 1194777894

View in Genome Browser
Species Human (GRCh38)
Location X:97988183-97988205
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194777890_1194777894 24 Left 1194777890 X:97988136-97988158 CCTTTAGCTTAGATCTCATAATG No data
Right 1194777894 X:97988183-97988205 AGCTGACTCACAGTCACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194777894 Original CRISPR AGCTGACTCACAGTCACTGA TGG Intergenic