ID: 1194780812

View in Genome Browser
Species Human (GRCh38)
Location X:98023370-98023392
Sequence GAACCTAGTCCCTTGAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194780812_1194780818 19 Left 1194780812 X:98023370-98023392 CCTCCCTTCAAGGGACTAGGTTC No data
Right 1194780818 X:98023412-98023434 TCTTTTGCTCACCTGATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194780812 Original CRISPR GAACCTAGTCCCTTGAAGGG AGG (reversed) Intergenic
No off target data available for this crispr