ID: 1194793508

View in Genome Browser
Species Human (GRCh38)
Location X:98181000-98181022
Sequence GACTCACTCAGCTCCGTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194793505_1194793508 7 Left 1194793505 X:98180970-98180992 CCTTTAAGCTTGTGTTACATAAG No data
Right 1194793508 X:98181000-98181022 GACTCACTCAGCTCCGTGATGGG No data
1194793504_1194793508 15 Left 1194793504 X:98180962-98180984 CCATTTCACCTTTAAGCTTGTGT No data
Right 1194793508 X:98181000-98181022 GACTCACTCAGCTCCGTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194793508 Original CRISPR GACTCACTCAGCTCCGTGAT GGG Intergenic
No off target data available for this crispr