ID: 1194794093

View in Genome Browser
Species Human (GRCh38)
Location X:98188506-98188528
Sequence TTTTGCCAAGACAAGATGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194794092_1194794093 7 Left 1194794092 X:98188476-98188498 CCATTATGACAAACATAGTGTTA No data
Right 1194794093 X:98188506-98188528 TTTTGCCAAGACAAGATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194794093 Original CRISPR TTTTGCCAAGACAAGATGAA AGG Intergenic
No off target data available for this crispr