ID: 1194797402

View in Genome Browser
Species Human (GRCh38)
Location X:98228621-98228643
Sequence CTAATTTACCTGTACTCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194797394_1194797402 12 Left 1194797394 X:98228586-98228608 CCCTATATTCGCCTATGCCCCAC No data
Right 1194797402 X:98228621-98228643 CTAATTTACCTGTACTCCATTGG No data
1194797396_1194797402 1 Left 1194797396 X:98228597-98228619 CCTATGCCCCACTCCCATCTGCA No data
Right 1194797402 X:98228621-98228643 CTAATTTACCTGTACTCCATTGG No data
1194797398_1194797402 -6 Left 1194797398 X:98228604-98228626 CCCACTCCCATCTGCAGCTAATT No data
Right 1194797402 X:98228621-98228643 CTAATTTACCTGTACTCCATTGG No data
1194797399_1194797402 -7 Left 1194797399 X:98228605-98228627 CCACTCCCATCTGCAGCTAATTT No data
Right 1194797402 X:98228621-98228643 CTAATTTACCTGTACTCCATTGG No data
1194797395_1194797402 11 Left 1194797395 X:98228587-98228609 CCTATATTCGCCTATGCCCCACT No data
Right 1194797402 X:98228621-98228643 CTAATTTACCTGTACTCCATTGG No data
1194797397_1194797402 -5 Left 1194797397 X:98228603-98228625 CCCCACTCCCATCTGCAGCTAAT No data
Right 1194797402 X:98228621-98228643 CTAATTTACCTGTACTCCATTGG No data
1194797393_1194797402 13 Left 1194797393 X:98228585-98228607 CCCCTATATTCGCCTATGCCCCA No data
Right 1194797402 X:98228621-98228643 CTAATTTACCTGTACTCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194797402 Original CRISPR CTAATTTACCTGTACTCCAT TGG Intergenic
No off target data available for this crispr