ID: 1194798618

View in Genome Browser
Species Human (GRCh38)
Location X:98242821-98242843
Sequence AAGGATGCACCATTTTATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194798618_1194798620 6 Left 1194798618 X:98242821-98242843 CCAGAATAAAATGGTGCATCCTT No data
Right 1194798620 X:98242850-98242872 AGTTTGAAGAATGACCAGAATGG No data
1194798618_1194798622 8 Left 1194798618 X:98242821-98242843 CCAGAATAAAATGGTGCATCCTT No data
Right 1194798622 X:98242852-98242874 TTTGAAGAATGACCAGAATGGGG No data
1194798618_1194798623 9 Left 1194798618 X:98242821-98242843 CCAGAATAAAATGGTGCATCCTT No data
Right 1194798623 X:98242853-98242875 TTGAAGAATGACCAGAATGGGGG No data
1194798618_1194798621 7 Left 1194798618 X:98242821-98242843 CCAGAATAAAATGGTGCATCCTT No data
Right 1194798621 X:98242851-98242873 GTTTGAAGAATGACCAGAATGGG No data
1194798618_1194798624 12 Left 1194798618 X:98242821-98242843 CCAGAATAAAATGGTGCATCCTT No data
Right 1194798624 X:98242856-98242878 AAGAATGACCAGAATGGGGGAGG No data
1194798618_1194798625 13 Left 1194798618 X:98242821-98242843 CCAGAATAAAATGGTGCATCCTT No data
Right 1194798625 X:98242857-98242879 AGAATGACCAGAATGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194798618 Original CRISPR AAGGATGCACCATTTTATTC TGG (reversed) Intergenic
No off target data available for this crispr