ID: 1194798619

View in Genome Browser
Species Human (GRCh38)
Location X:98242840-98242862
Sequence CATTCTTCAAACTAAGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194798619_1194798627 14 Left 1194798619 X:98242840-98242862 CCTTCATCTTAGTTTGAAGAATG No data
Right 1194798627 X:98242877-98242899 GGGAGCATTAAAATGAAAAATGG No data
1194798619_1194798624 -7 Left 1194798619 X:98242840-98242862 CCTTCATCTTAGTTTGAAGAATG No data
Right 1194798624 X:98242856-98242878 AAGAATGACCAGAATGGGGGAGG No data
1194798619_1194798625 -6 Left 1194798619 X:98242840-98242862 CCTTCATCTTAGTTTGAAGAATG No data
Right 1194798625 X:98242857-98242879 AGAATGACCAGAATGGGGGAGGG No data
1194798619_1194798623 -10 Left 1194798619 X:98242840-98242862 CCTTCATCTTAGTTTGAAGAATG No data
Right 1194798623 X:98242853-98242875 TTGAAGAATGACCAGAATGGGGG No data
1194798619_1194798628 23 Left 1194798619 X:98242840-98242862 CCTTCATCTTAGTTTGAAGAATG No data
Right 1194798628 X:98242886-98242908 AAAATGAAAAATGGTCATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194798619 Original CRISPR CATTCTTCAAACTAAGATGA AGG (reversed) Intergenic
No off target data available for this crispr