ID: 1194798624

View in Genome Browser
Species Human (GRCh38)
Location X:98242856-98242878
Sequence AAGAATGACCAGAATGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194798616_1194798624 14 Left 1194798616 X:98242819-98242841 CCCCAGAATAAAATGGTGCATCC No data
Right 1194798624 X:98242856-98242878 AAGAATGACCAGAATGGGGGAGG No data
1194798617_1194798624 13 Left 1194798617 X:98242820-98242842 CCCAGAATAAAATGGTGCATCCT No data
Right 1194798624 X:98242856-98242878 AAGAATGACCAGAATGGGGGAGG No data
1194798618_1194798624 12 Left 1194798618 X:98242821-98242843 CCAGAATAAAATGGTGCATCCTT No data
Right 1194798624 X:98242856-98242878 AAGAATGACCAGAATGGGGGAGG No data
1194798619_1194798624 -7 Left 1194798619 X:98242840-98242862 CCTTCATCTTAGTTTGAAGAATG No data
Right 1194798624 X:98242856-98242878 AAGAATGACCAGAATGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194798624 Original CRISPR AAGAATGACCAGAATGGGGG AGG Intergenic
No off target data available for this crispr