ID: 1194799874

View in Genome Browser
Species Human (GRCh38)
Location X:98259597-98259619
Sequence CTGTATGTACACCTTTTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194799872_1194799874 28 Left 1194799872 X:98259546-98259568 CCATTAAATACATTAAATAAAAA No data
Right 1194799874 X:98259597-98259619 CTGTATGTACACCTTTTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194799874 Original CRISPR CTGTATGTACACCTTTTACA AGG Intergenic
No off target data available for this crispr