ID: 1194800233

View in Genome Browser
Species Human (GRCh38)
Location X:98264102-98264124
Sequence CCCCGAGCAACCACCATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194800223_1194800233 9 Left 1194800223 X:98264070-98264092 CCACATCCCTGGAGCCCCACTGG No data
Right 1194800233 X:98264102-98264124 CCCCGAGCAACCACCATGGCTGG No data
1194800229_1194800233 -7 Left 1194800229 X:98264086-98264108 CCACTGGCATTGCCTACCCCGAG No data
Right 1194800233 X:98264102-98264124 CCCCGAGCAACCACCATGGCTGG No data
1194800227_1194800233 -5 Left 1194800227 X:98264084-98264106 CCCCACTGGCATTGCCTACCCCG No data
Right 1194800233 X:98264102-98264124 CCCCGAGCAACCACCATGGCTGG No data
1194800225_1194800233 3 Left 1194800225 X:98264076-98264098 CCCTGGAGCCCCACTGGCATTGC No data
Right 1194800233 X:98264102-98264124 CCCCGAGCAACCACCATGGCTGG No data
1194800226_1194800233 2 Left 1194800226 X:98264077-98264099 CCTGGAGCCCCACTGGCATTGCC No data
Right 1194800233 X:98264102-98264124 CCCCGAGCAACCACCATGGCTGG No data
1194800228_1194800233 -6 Left 1194800228 X:98264085-98264107 CCCACTGGCATTGCCTACCCCGA No data
Right 1194800233 X:98264102-98264124 CCCCGAGCAACCACCATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194800233 Original CRISPR CCCCGAGCAACCACCATGGC TGG Intergenic
No off target data available for this crispr