ID: 1194809465

View in Genome Browser
Species Human (GRCh38)
Location X:98373035-98373057
Sequence GTGAATAACTGGATGGTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194809458_1194809465 26 Left 1194809458 X:98372986-98373008 CCGTTGTAACCCTAGCAACTAGC No data
Right 1194809465 X:98373035-98373057 GTGAATAACTGGATGGTTAGAGG No data
1194809460_1194809465 16 Left 1194809460 X:98372996-98373018 CCTAGCAACTAGCACAGTGCTGG No data
Right 1194809465 X:98373035-98373057 GTGAATAACTGGATGGTTAGAGG No data
1194809459_1194809465 17 Left 1194809459 X:98372995-98373017 CCCTAGCAACTAGCACAGTGCTG No data
Right 1194809465 X:98373035-98373057 GTGAATAACTGGATGGTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194809465 Original CRISPR GTGAATAACTGGATGGTTAG AGG Intergenic
No off target data available for this crispr