ID: 1194810260

View in Genome Browser
Species Human (GRCh38)
Location X:98380292-98380314
Sequence GCTCCCCTCCCGGCCAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194810260_1194810274 28 Left 1194810260 X:98380292-98380314 CCAGCTCTGGCCGGGAGGGGAGC No data
Right 1194810274 X:98380343-98380365 CGCGCGTGCCTGCAGCCATTGGG No data
1194810260_1194810275 29 Left 1194810260 X:98380292-98380314 CCAGCTCTGGCCGGGAGGGGAGC No data
Right 1194810275 X:98380344-98380366 GCGCGTGCCTGCAGCCATTGGGG No data
1194810260_1194810273 27 Left 1194810260 X:98380292-98380314 CCAGCTCTGGCCGGGAGGGGAGC No data
Right 1194810273 X:98380342-98380364 CCGCGCGTGCCTGCAGCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194810260 Original CRISPR GCTCCCCTCCCGGCCAGAGC TGG (reversed) Intergenic
No off target data available for this crispr