ID: 1194810264

View in Genome Browser
Species Human (GRCh38)
Location X:98380302-98380324
Sequence CGGCTCCCCAGCTCCCCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194810264_1194810273 17 Left 1194810264 X:98380302-98380324 CCGGGAGGGGAGCTGGGGAGCCG No data
Right 1194810273 X:98380342-98380364 CCGCGCGTGCCTGCAGCCATTGG No data
1194810264_1194810278 24 Left 1194810264 X:98380302-98380324 CCGGGAGGGGAGCTGGGGAGCCG No data
Right 1194810278 X:98380349-98380371 TGCCTGCAGCCATTGGGGTGGGG 0: 3
1: 4
2: 11
3: 45
4: 267
1194810264_1194810274 18 Left 1194810264 X:98380302-98380324 CCGGGAGGGGAGCTGGGGAGCCG No data
Right 1194810274 X:98380343-98380365 CGCGCGTGCCTGCAGCCATTGGG No data
1194810264_1194810277 23 Left 1194810264 X:98380302-98380324 CCGGGAGGGGAGCTGGGGAGCCG No data
Right 1194810277 X:98380348-98380370 GTGCCTGCAGCCATTGGGGTGGG No data
1194810264_1194810276 22 Left 1194810264 X:98380302-98380324 CCGGGAGGGGAGCTGGGGAGCCG No data
Right 1194810276 X:98380347-98380369 CGTGCCTGCAGCCATTGGGGTGG No data
1194810264_1194810280 27 Left 1194810264 X:98380302-98380324 CCGGGAGGGGAGCTGGGGAGCCG No data
Right 1194810280 X:98380352-98380374 CTGCAGCCATTGGGGTGGGGTGG No data
1194810264_1194810275 19 Left 1194810264 X:98380302-98380324 CCGGGAGGGGAGCTGGGGAGCCG No data
Right 1194810275 X:98380344-98380366 GCGCGTGCCTGCAGCCATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194810264 Original CRISPR CGGCTCCCCAGCTCCCCTCC CGG (reversed) Intergenic
No off target data available for this crispr