ID: 1194810265

View in Genome Browser
Species Human (GRCh38)
Location X:98380322-98380344
Sequence CGGGATGGATTGGGGAATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194810265_1194810276 2 Left 1194810265 X:98380322-98380344 CCGCCATTCCCCAATCCATCCCG No data
Right 1194810276 X:98380347-98380369 CGTGCCTGCAGCCATTGGGGTGG No data
1194810265_1194810273 -3 Left 1194810265 X:98380322-98380344 CCGCCATTCCCCAATCCATCCCG No data
Right 1194810273 X:98380342-98380364 CCGCGCGTGCCTGCAGCCATTGG No data
1194810265_1194810280 7 Left 1194810265 X:98380322-98380344 CCGCCATTCCCCAATCCATCCCG No data
Right 1194810280 X:98380352-98380374 CTGCAGCCATTGGGGTGGGGTGG No data
1194810265_1194810282 30 Left 1194810265 X:98380322-98380344 CCGCCATTCCCCAATCCATCCCG No data
Right 1194810282 X:98380375-98380397 TGTGCAGTTTCTTCTACCCTCGG No data
1194810265_1194810275 -1 Left 1194810265 X:98380322-98380344 CCGCCATTCCCCAATCCATCCCG No data
Right 1194810275 X:98380344-98380366 GCGCGTGCCTGCAGCCATTGGGG No data
1194810265_1194810278 4 Left 1194810265 X:98380322-98380344 CCGCCATTCCCCAATCCATCCCG No data
Right 1194810278 X:98380349-98380371 TGCCTGCAGCCATTGGGGTGGGG 0: 3
1: 4
2: 11
3: 45
4: 267
1194810265_1194810277 3 Left 1194810265 X:98380322-98380344 CCGCCATTCCCCAATCCATCCCG No data
Right 1194810277 X:98380348-98380370 GTGCCTGCAGCCATTGGGGTGGG No data
1194810265_1194810274 -2 Left 1194810265 X:98380322-98380344 CCGCCATTCCCCAATCCATCCCG No data
Right 1194810274 X:98380343-98380365 CGCGCGTGCCTGCAGCCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194810265 Original CRISPR CGGGATGGATTGGGGAATGG CGG (reversed) Intergenic
No off target data available for this crispr