ID: 1194810273

View in Genome Browser
Species Human (GRCh38)
Location X:98380342-98380364
Sequence CCGCGCGTGCCTGCAGCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194810260_1194810273 27 Left 1194810260 X:98380292-98380314 CCAGCTCTGGCCGGGAGGGGAGC No data
Right 1194810273 X:98380342-98380364 CCGCGCGTGCCTGCAGCCATTGG No data
1194810264_1194810273 17 Left 1194810264 X:98380302-98380324 CCGGGAGGGGAGCTGGGGAGCCG No data
Right 1194810273 X:98380342-98380364 CCGCGCGTGCCTGCAGCCATTGG No data
1194810266_1194810273 -6 Left 1194810266 X:98380325-98380347 CCATTCCCCAATCCATCCCGCGC No data
Right 1194810273 X:98380342-98380364 CCGCGCGTGCCTGCAGCCATTGG No data
1194810265_1194810273 -3 Left 1194810265 X:98380322-98380344 CCGCCATTCCCCAATCCATCCCG No data
Right 1194810273 X:98380342-98380364 CCGCGCGTGCCTGCAGCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194810273 Original CRISPR CCGCGCGTGCCTGCAGCCAT TGG Intergenic
No off target data available for this crispr