ID: 1194829805

View in Genome Browser
Species Human (GRCh38)
Location X:98608505-98608527
Sequence CTAATTAATCATATGGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194829805_1194829812 3 Left 1194829805 X:98608505-98608527 CCCTACCCCATATGATTAATTAG No data
Right 1194829812 X:98608531-98608553 CAATTGTGAATCCCTAGGGTAGG No data
1194829805_1194829813 9 Left 1194829805 X:98608505-98608527 CCCTACCCCATATGATTAATTAG No data
Right 1194829813 X:98608537-98608559 TGAATCCCTAGGGTAGGAAGTGG No data
1194829805_1194829811 -1 Left 1194829805 X:98608505-98608527 CCCTACCCCATATGATTAATTAG No data
Right 1194829811 X:98608527-98608549 GTAACAATTGTGAATCCCTAGGG No data
1194829805_1194829810 -2 Left 1194829805 X:98608505-98608527 CCCTACCCCATATGATTAATTAG No data
Right 1194829810 X:98608526-98608548 AGTAACAATTGTGAATCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194829805 Original CRISPR CTAATTAATCATATGGGGTA GGG (reversed) Intergenic
No off target data available for this crispr