ID: 1194831978

View in Genome Browser
Species Human (GRCh38)
Location X:98634276-98634298
Sequence TTGTGGTTTTTATAAATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194831978_1194831983 27 Left 1194831978 X:98634276-98634298 CCTAAAATTTATAAAAACCACAA No data
Right 1194831983 X:98634326-98634348 GAGGAAAAAGTGCAAAACTCAGG No data
1194831978_1194831981 8 Left 1194831978 X:98634276-98634298 CCTAAAATTTATAAAAACCACAA No data
Right 1194831981 X:98634307-98634329 GTATAGCCAAAGCTATCTTGAGG No data
1194831978_1194831984 28 Left 1194831978 X:98634276-98634298 CCTAAAATTTATAAAAACCACAA No data
Right 1194831984 X:98634327-98634349 AGGAAAAAGTGCAAAACTCAGGG No data
1194831978_1194831985 29 Left 1194831978 X:98634276-98634298 CCTAAAATTTATAAAAACCACAA No data
Right 1194831985 X:98634328-98634350 GGAAAAAGTGCAAAACTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194831978 Original CRISPR TTGTGGTTTTTATAAATTTT AGG (reversed) Intergenic
No off target data available for this crispr