ID: 1194831981

View in Genome Browser
Species Human (GRCh38)
Location X:98634307-98634329
Sequence GTATAGCCAAAGCTATCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194831978_1194831981 8 Left 1194831978 X:98634276-98634298 CCTAAAATTTATAAAAACCACAA No data
Right 1194831981 X:98634307-98634329 GTATAGCCAAAGCTATCTTGAGG No data
1194831979_1194831981 -9 Left 1194831979 X:98634293-98634315 CCACAAAAGACCTAGTATAGCCA No data
Right 1194831981 X:98634307-98634329 GTATAGCCAAAGCTATCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194831981 Original CRISPR GTATAGCCAAAGCTATCTTG AGG Intergenic
No off target data available for this crispr