ID: 1194833955

View in Genome Browser
Species Human (GRCh38)
Location X:98658772-98658794
Sequence AGTTATCTGCAGAAGGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194833955_1194833959 15 Left 1194833955 X:98658772-98658794 CCTGGGACCTTCTGCAGATAACT No data
Right 1194833959 X:98658810-98658832 GCGAGCTCTTGGCCTGTTACTGG No data
1194833955_1194833960 16 Left 1194833955 X:98658772-98658794 CCTGGGACCTTCTGCAGATAACT No data
Right 1194833960 X:98658811-98658833 CGAGCTCTTGGCCTGTTACTGGG No data
1194833955_1194833957 4 Left 1194833955 X:98658772-98658794 CCTGGGACCTTCTGCAGATAACT No data
Right 1194833957 X:98658799-98658821 TCCTTTTGAGAGCGAGCTCTTGG No data
1194833955_1194833961 22 Left 1194833955 X:98658772-98658794 CCTGGGACCTTCTGCAGATAACT No data
Right 1194833961 X:98658817-98658839 CTTGGCCTGTTACTGGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194833955 Original CRISPR AGTTATCTGCAGAAGGTCCC AGG (reversed) Intergenic
No off target data available for this crispr