ID: 1194833959

View in Genome Browser
Species Human (GRCh38)
Location X:98658810-98658832
Sequence GCGAGCTCTTGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194833956_1194833959 8 Left 1194833956 X:98658779-98658801 CCTTCTGCAGATAACTGCTCTCC No data
Right 1194833959 X:98658810-98658832 GCGAGCTCTTGGCCTGTTACTGG No data
1194833955_1194833959 15 Left 1194833955 X:98658772-98658794 CCTGGGACCTTCTGCAGATAACT No data
Right 1194833959 X:98658810-98658832 GCGAGCTCTTGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194833959 Original CRISPR GCGAGCTCTTGGCCTGTTAC TGG Intergenic
No off target data available for this crispr