ID: 1194839934

View in Genome Browser
Species Human (GRCh38)
Location X:98727518-98727540
Sequence TATTATGTATTTTCACTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194839933_1194839934 29 Left 1194839933 X:98727466-98727488 CCTTGCTCAACACTATATTTTGA No data
Right 1194839934 X:98727518-98727540 TATTATGTATTTTCACTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194839934 Original CRISPR TATTATGTATTTTCACTTTA AGG Intergenic
No off target data available for this crispr