ID: 1194845742

View in Genome Browser
Species Human (GRCh38)
Location X:98806715-98806737
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194845742_1194845746 10 Left 1194845742 X:98806715-98806737 CCCCTTGGTGCACATACATAATC No data
Right 1194845746 X:98806748-98806770 AAATCCATATATTATTTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194845742 Original CRISPR GATTATGTATGTGCACCAAG GGG (reversed) Intergenic
No off target data available for this crispr