ID: 1194866188

View in Genome Browser
Species Human (GRCh38)
Location X:99070911-99070933
Sequence TAGTAGACGCATAATCAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194866188_1194866191 23 Left 1194866188 X:99070911-99070933 CCTACTTGATTATGCGTCTACTA No data
Right 1194866191 X:99070957-99070979 CCTGTGTTATAGACTGAAGAGGG No data
1194866188_1194866189 22 Left 1194866188 X:99070911-99070933 CCTACTTGATTATGCGTCTACTA No data
Right 1194866189 X:99070956-99070978 ACCTGTGTTATAGACTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194866188 Original CRISPR TAGTAGACGCATAATCAAGT AGG (reversed) Intergenic
No off target data available for this crispr