ID: 1194866188 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:99070911-99070933 |
| Sequence | TAGTAGACGCATAATCAAGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1194866188_1194866191 | 23 | Left | 1194866188 | X:99070911-99070933 | CCTACTTGATTATGCGTCTACTA | No data | ||
| Right | 1194866191 | X:99070957-99070979 | CCTGTGTTATAGACTGAAGAGGG | No data | ||||
| 1194866188_1194866189 | 22 | Left | 1194866188 | X:99070911-99070933 | CCTACTTGATTATGCGTCTACTA | No data | ||
| Right | 1194866189 | X:99070956-99070978 | ACCTGTGTTATAGACTGAAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1194866188 | Original CRISPR | TAGTAGACGCATAATCAAGT AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||