ID: 1194872192

View in Genome Browser
Species Human (GRCh38)
Location X:99146380-99146402
Sequence GCAGCCTGCTTGGCTGGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194872188_1194872192 6 Left 1194872188 X:99146351-99146373 CCTAAAACAAGGAAAGAGAGGGA No data
Right 1194872192 X:99146380-99146402 GCAGCCTGCTTGGCTGGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194872192 Original CRISPR GCAGCCTGCTTGGCTGGAAT TGG Intergenic
No off target data available for this crispr