ID: 1194874589

View in Genome Browser
Species Human (GRCh38)
Location X:99171205-99171227
Sequence TGATGGTCACAGGTTCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194874589_1194874593 0 Left 1194874589 X:99171205-99171227 CCAAGCTGAACCTGTGACCATCA No data
Right 1194874593 X:99171228-99171250 CTCATTAACTCTGGTGCTAGTGG No data
1194874589_1194874591 -9 Left 1194874589 X:99171205-99171227 CCAAGCTGAACCTGTGACCATCA No data
Right 1194874591 X:99171219-99171241 TGACCATCACTCATTAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194874589 Original CRISPR TGATGGTCACAGGTTCAGCT TGG (reversed) Intergenic
No off target data available for this crispr