ID: 1194875103

View in Genome Browser
Species Human (GRCh38)
Location X:99177404-99177426
Sequence AAGCGAGAACATGCAGTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 31703
Summary {0: 26, 1: 1295, 2: 3210, 3: 10223, 4: 16949}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194875103_1194875107 27 Left 1194875103 X:99177404-99177426 CCAAATACTGCATGTTCTCGCTT 0: 26
1: 1295
2: 3210
3: 10223
4: 16949
Right 1194875107 X:99177454-99177476 CATGGCCTATTGAAGTATGGAGG No data
1194875103_1194875106 24 Left 1194875103 X:99177404-99177426 CCAAATACTGCATGTTCTCGCTT 0: 26
1: 1295
2: 3210
3: 10223
4: 16949
Right 1194875106 X:99177451-99177473 ACACATGGCCTATTGAAGTATGG No data
1194875103_1194875105 9 Left 1194875103 X:99177404-99177426 CCAAATACTGCATGTTCTCGCTT 0: 26
1: 1295
2: 3210
3: 10223
4: 16949
Right 1194875105 X:99177436-99177458 AGCTAAATGATGAGAACACATGG 0: 1304
1: 2240
2: 2066
3: 3710
4: 10721

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194875103 Original CRISPR AAGCGAGAACATGCAGTATT TGG (reversed) Intergenic
Too many off-targets to display for this crispr