ID: 1194875107

View in Genome Browser
Species Human (GRCh38)
Location X:99177454-99177476
Sequence CATGGCCTATTGAAGTATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194875103_1194875107 27 Left 1194875103 X:99177404-99177426 CCAAATACTGCATGTTCTCGCTT 0: 26
1: 1295
2: 3210
3: 10223
4: 16949
Right 1194875107 X:99177454-99177476 CATGGCCTATTGAAGTATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194875107 Original CRISPR CATGGCCTATTGAAGTATGG AGG Intergenic
No off target data available for this crispr