ID: 1194882230

View in Genome Browser
Species Human (GRCh38)
Location X:99268103-99268125
Sequence TGAACCCCTTTTACAATAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194882230_1194882231 -10 Left 1194882230 X:99268103-99268125 CCAGCTATTGTAAAAGGGGTTCA No data
Right 1194882231 X:99268116-99268138 AAGGGGTTCACTTCTTGATTTGG No data
1194882230_1194882232 13 Left 1194882230 X:99268103-99268125 CCAGCTATTGTAAAAGGGGTTCA No data
Right 1194882232 X:99268139-99268161 ACTCTCAACTTGATTGCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194882230 Original CRISPR TGAACCCCTTTTACAATAGC TGG (reversed) Intergenic
No off target data available for this crispr