ID: 1194882730

View in Genome Browser
Species Human (GRCh38)
Location X:99273864-99273886
Sequence TACTGCCTGGGGTCAAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194882730_1194882738 24 Left 1194882730 X:99273864-99273886 CCCTCCCTTGACCCCAGGCAGTA No data
Right 1194882738 X:99273911-99273933 CTTTCATTCCACTTGAGGAAAGG No data
1194882730_1194882737 19 Left 1194882730 X:99273864-99273886 CCCTCCCTTGACCCCAGGCAGTA No data
Right 1194882737 X:99273906-99273928 TGAATCTTTCATTCCACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194882730 Original CRISPR TACTGCCTGGGGTCAAGGGA GGG (reversed) Intergenic
No off target data available for this crispr