ID: 1194884878

View in Genome Browser
Species Human (GRCh38)
Location X:99301715-99301737
Sequence CAGGGTTATGTGATGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194884872_1194884878 6 Left 1194884872 X:99301686-99301708 CCTATTGTGAAGCTTGTATTAAG No data
Right 1194884878 X:99301715-99301737 CAGGGTTATGTGATGGAGGATGG No data
1194884871_1194884878 26 Left 1194884871 X:99301666-99301688 CCATTAATGTTCTACTCTCTCCT No data
Right 1194884878 X:99301715-99301737 CAGGGTTATGTGATGGAGGATGG No data
1194884870_1194884878 27 Left 1194884870 X:99301665-99301687 CCCATTAATGTTCTACTCTCTCC No data
Right 1194884878 X:99301715-99301737 CAGGGTTATGTGATGGAGGATGG No data
1194884869_1194884878 28 Left 1194884869 X:99301664-99301686 CCCCATTAATGTTCTACTCTCTC No data
Right 1194884878 X:99301715-99301737 CAGGGTTATGTGATGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194884878 Original CRISPR CAGGGTTATGTGATGGAGGA TGG Intergenic
No off target data available for this crispr