ID: 1194910798

View in Genome Browser
Species Human (GRCh38)
Location X:99642019-99642041
Sequence CCTGCTCTGCAGGAGCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194910798_1194910802 -2 Left 1194910798 X:99642019-99642041 CCAGCCAGCTCCTGCAGAGCAGG No data
Right 1194910802 X:99642040-99642062 GGTCTTTACTATACTTCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194910798 Original CRISPR CCTGCTCTGCAGGAGCTGGC TGG (reversed) Intergenic
No off target data available for this crispr