ID: 1194920346

View in Genome Browser
Species Human (GRCh38)
Location X:99758060-99758082
Sequence TGCCATAGCCCTTGGTGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194920346_1194920349 5 Left 1194920346 X:99758060-99758082 CCTTGCCACCAAGGGCTATGGCA No data
Right 1194920349 X:99758088-99758110 TGCCTAAAAGTAAAATATAAAGG No data
1194920346_1194920351 22 Left 1194920346 X:99758060-99758082 CCTTGCCACCAAGGGCTATGGCA No data
Right 1194920351 X:99758105-99758127 TAAAGGCAGTCTAAACCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194920346 Original CRISPR TGCCATAGCCCTTGGTGGCA AGG (reversed) Intergenic
No off target data available for this crispr