ID: 1194926141

View in Genome Browser
Species Human (GRCh38)
Location X:99826599-99826621
Sequence CAGTTCCAATGGAAGAACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194926137_1194926141 29 Left 1194926137 X:99826547-99826569 CCTAGTTCATCAACACTGCAGGT No data
Right 1194926141 X:99826599-99826621 CAGTTCCAATGGAAGAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194926141 Original CRISPR CAGTTCCAATGGAAGAACTG TGG Intergenic
No off target data available for this crispr