ID: 1194931963

View in Genome Browser
Species Human (GRCh38)
Location X:99900003-99900025
Sequence ACCTTTAAGCAGGACCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194931963_1194931974 10 Left 1194931963 X:99900003-99900025 CCCTCCAGGTCCTGCTTAAAGGT No data
Right 1194931974 X:99900036-99900058 CCCCAGGGAAAAATCCAGGGTGG No data
1194931963_1194931968 -5 Left 1194931963 X:99900003-99900025 CCCTCCAGGTCCTGCTTAAAGGT No data
Right 1194931968 X:99900021-99900043 AAGGTCCATAAATACCCCCAGGG No data
1194931963_1194931970 6 Left 1194931963 X:99900003-99900025 CCCTCCAGGTCCTGCTTAAAGGT No data
Right 1194931970 X:99900032-99900054 ATACCCCCAGGGAAAAATCCAGG No data
1194931963_1194931967 -6 Left 1194931963 X:99900003-99900025 CCCTCCAGGTCCTGCTTAAAGGT No data
Right 1194931967 X:99900020-99900042 AAAGGTCCATAAATACCCCCAGG No data
1194931963_1194931971 7 Left 1194931963 X:99900003-99900025 CCCTCCAGGTCCTGCTTAAAGGT No data
Right 1194931971 X:99900033-99900055 TACCCCCAGGGAAAAATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194931963 Original CRISPR ACCTTTAAGCAGGACCTGGA GGG (reversed) Intergenic
No off target data available for this crispr