ID: 1194931966

View in Genome Browser
Species Human (GRCh38)
Location X:99900013-99900035
Sequence GTATTTATGGACCTTTAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194931966_1194931978 23 Left 1194931966 X:99900013-99900035 CCTGCTTAAAGGTCCATAAATAC No data
Right 1194931978 X:99900059-99900081 TGCTCTCAGTCCCCTTGCTGAGG No data
1194931966_1194931974 0 Left 1194931966 X:99900013-99900035 CCTGCTTAAAGGTCCATAAATAC No data
Right 1194931974 X:99900036-99900058 CCCCAGGGAAAAATCCAGGGTGG No data
1194931966_1194931971 -3 Left 1194931966 X:99900013-99900035 CCTGCTTAAAGGTCCATAAATAC No data
Right 1194931971 X:99900033-99900055 TACCCCCAGGGAAAAATCCAGGG No data
1194931966_1194931970 -4 Left 1194931966 X:99900013-99900035 CCTGCTTAAAGGTCCATAAATAC No data
Right 1194931970 X:99900032-99900054 ATACCCCCAGGGAAAAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194931966 Original CRISPR GTATTTATGGACCTTTAAGC AGG (reversed) Intergenic
No off target data available for this crispr