ID: 1194931967

View in Genome Browser
Species Human (GRCh38)
Location X:99900020-99900042
Sequence AAAGGTCCATAAATACCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194931965_1194931967 -10 Left 1194931965 X:99900007-99900029 CCAGGTCCTGCTTAAAGGTCCAT No data
Right 1194931967 X:99900020-99900042 AAAGGTCCATAAATACCCCCAGG No data
1194931964_1194931967 -7 Left 1194931964 X:99900004-99900026 CCTCCAGGTCCTGCTTAAAGGTC No data
Right 1194931967 X:99900020-99900042 AAAGGTCCATAAATACCCCCAGG No data
1194931963_1194931967 -6 Left 1194931963 X:99900003-99900025 CCCTCCAGGTCCTGCTTAAAGGT No data
Right 1194931967 X:99900020-99900042 AAAGGTCCATAAATACCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194931967 Original CRISPR AAAGGTCCATAAATACCCCC AGG Intergenic
No off target data available for this crispr