ID: 1194931970

View in Genome Browser
Species Human (GRCh38)
Location X:99900032-99900054
Sequence ATACCCCCAGGGAAAAATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194931964_1194931970 5 Left 1194931964 X:99900004-99900026 CCTCCAGGTCCTGCTTAAAGGTC No data
Right 1194931970 X:99900032-99900054 ATACCCCCAGGGAAAAATCCAGG No data
1194931963_1194931970 6 Left 1194931963 X:99900003-99900025 CCCTCCAGGTCCTGCTTAAAGGT No data
Right 1194931970 X:99900032-99900054 ATACCCCCAGGGAAAAATCCAGG No data
1194931965_1194931970 2 Left 1194931965 X:99900007-99900029 CCAGGTCCTGCTTAAAGGTCCAT No data
Right 1194931970 X:99900032-99900054 ATACCCCCAGGGAAAAATCCAGG No data
1194931966_1194931970 -4 Left 1194931966 X:99900013-99900035 CCTGCTTAAAGGTCCATAAATAC No data
Right 1194931970 X:99900032-99900054 ATACCCCCAGGGAAAAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194931970 Original CRISPR ATACCCCCAGGGAAAAATCC AGG Intergenic
No off target data available for this crispr