ID: 1194931975

View in Genome Browser
Species Human (GRCh38)
Location X:99900037-99900059
Sequence ACCACCCTGGATTTTTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194931975_1194931978 -1 Left 1194931975 X:99900037-99900059 CCCAGGGAAAAATCCAGGGTGGT No data
Right 1194931978 X:99900059-99900081 TGCTCTCAGTCCCCTTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194931975 Original CRISPR ACCACCCTGGATTTTTCCCT GGG (reversed) Intergenic
No off target data available for this crispr