ID: 1194931976

View in Genome Browser
Species Human (GRCh38)
Location X:99900038-99900060
Sequence CACCACCCTGGATTTTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194931976_1194931978 -2 Left 1194931976 X:99900038-99900060 CCAGGGAAAAATCCAGGGTGGTG No data
Right 1194931978 X:99900059-99900081 TGCTCTCAGTCCCCTTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194931976 Original CRISPR CACCACCCTGGATTTTTCCC TGG (reversed) Intergenic
No off target data available for this crispr