ID: 1194931978

View in Genome Browser
Species Human (GRCh38)
Location X:99900059-99900081
Sequence TGCTCTCAGTCCCCTTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194931966_1194931978 23 Left 1194931966 X:99900013-99900035 CCTGCTTAAAGGTCCATAAATAC No data
Right 1194931978 X:99900059-99900081 TGCTCTCAGTCCCCTTGCTGAGG No data
1194931976_1194931978 -2 Left 1194931976 X:99900038-99900060 CCAGGGAAAAATCCAGGGTGGTG No data
Right 1194931978 X:99900059-99900081 TGCTCTCAGTCCCCTTGCTGAGG No data
1194931972_1194931978 1 Left 1194931972 X:99900035-99900057 CCCCCAGGGAAAAATCCAGGGTG No data
Right 1194931978 X:99900059-99900081 TGCTCTCAGTCCCCTTGCTGAGG No data
1194931965_1194931978 29 Left 1194931965 X:99900007-99900029 CCAGGTCCTGCTTAAAGGTCCAT No data
Right 1194931978 X:99900059-99900081 TGCTCTCAGTCCCCTTGCTGAGG No data
1194931969_1194931978 10 Left 1194931969 X:99900026-99900048 CCATAAATACCCCCAGGGAAAAA No data
Right 1194931978 X:99900059-99900081 TGCTCTCAGTCCCCTTGCTGAGG No data
1194931975_1194931978 -1 Left 1194931975 X:99900037-99900059 CCCAGGGAAAAATCCAGGGTGGT No data
Right 1194931978 X:99900059-99900081 TGCTCTCAGTCCCCTTGCTGAGG No data
1194931973_1194931978 0 Left 1194931973 X:99900036-99900058 CCCCAGGGAAAAATCCAGGGTGG No data
Right 1194931978 X:99900059-99900081 TGCTCTCAGTCCCCTTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194931978 Original CRISPR TGCTCTCAGTCCCCTTGCTG AGG Intergenic
No off target data available for this crispr