ID: 1194935970

View in Genome Browser
Species Human (GRCh38)
Location X:99949420-99949442
Sequence CACCATGTATACATGTGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194935964_1194935970 20 Left 1194935964 X:99949377-99949399 CCACACCCAGCTAACTTTTGTAT 0: 373
1: 18996
2: 46469
3: 90276
4: 107130
Right 1194935970 X:99949420-99949442 CACCATGTATACATGTGCCATGG No data
1194935965_1194935970 15 Left 1194935965 X:99949382-99949404 CCCAGCTAACTTTTGTATTTTCA 0: 57
1: 3580
2: 68216
3: 136271
4: 99713
Right 1194935970 X:99949420-99949442 CACCATGTATACATGTGCCATGG No data
1194935966_1194935970 14 Left 1194935966 X:99949383-99949405 CCAGCTAACTTTTGTATTTTCAG 0: 83
1: 5233
2: 91333
3: 72077
4: 46006
Right 1194935970 X:99949420-99949442 CACCATGTATACATGTGCCATGG No data
1194935963_1194935970 23 Left 1194935963 X:99949374-99949396 CCACCACACCCAGCTAACTTTTG 0: 379
1: 19409
2: 57206
3: 124970
4: 178281
Right 1194935970 X:99949420-99949442 CACCATGTATACATGTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194935970 Original CRISPR CACCATGTATACATGTGCCA TGG Intergenic
No off target data available for this crispr