ID: 1194937148

View in Genome Browser
Species Human (GRCh38)
Location X:99964570-99964592
Sequence CTGCACCCATGTCCCTACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194937148_1194937151 12 Left 1194937148 X:99964570-99964592 CCTTTGTAGGGACATGGGTGCAG No data
Right 1194937151 X:99964605-99964627 ATTCTCAGCAAACTATTGCAAGG 0: 1288
1: 5350
2: 7196
3: 4038
4: 1537

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194937148 Original CRISPR CTGCACCCATGTCCCTACAA AGG (reversed) Intergenic
No off target data available for this crispr